diff - Perl while loops and reading lines

Question

Each record has 4 lines:

Like the following:

@NCYC361-11a03.q1k?bases?1?to?1576
GCGTGCCCGAAAAAATGCTTTTGGAGCCGCGCGTGAAAT
+
!)))))****(((***%%((((*(((+,**(((+**+,-

There are two files in which 1 file corresponded to the other

there are an array of seqeunces A1 So read 1 record at a time from file 1. read record from file 2. if the sequence in record 1 file 1 (line 2) matches the seuqnece in the array A1, i print the record from file 2 to an output file so on...but the point is i need to read a record at a time.... how would i break out of the inner loop so that i can read the next record from the file 1 and then compare it to the next record in file 2

Answer 1

If you ask about controlling nested loops you can do that with labels.

Example:

OUTER:
while(<>){
    for(@something){
        last OUTER;
    }
}

See last for example.