regex - How to find substring from string in R?

Question

If my string is a DNA sequence,

x<-"TATAATGCAACGAGGGGCATAATTATATATGCCCAAAATCTGATATAATGACCGGGTAG"

I want to extract substring from ATG to TAA, TGA or TAG. I am able to extract from one point to another by using stringi package with regex.

My code is

stri_extract_all(x, regex = "ATG.*?TAA")

Help me by solving my query.

Answer 1

I believe that you meant str_extract_all from the stringr package. That function does not have an argument called regex; you need pattern. Once you get by that, you can just use or | to allow any of the sequence endings.

library(stringr)
str_extract_all(x, pattern="ATG.*?(TAA|TGA|TAG)")
[[1]]
[1] "ATGCAACGAGGGGCATAA" "ATGCCCAAAATCTGA"    "ATGACCGGGTAG"