Mapping letters to integers in MATLAB

Question

The function arithenco needs the input message to be a sequence of positive integers. Hence, I need convert a message into a sequence of numbers message_int, by using the following mapping.

‘A’→1, ‘C’→2, ‘G’→3, ‘T’→4.

Answer 1

From what I understand, the alphabet you are using contains only four values A,C,G,T (DNA sequences I suppose).

Simple comparison would suffice:

seq = 'TGGAGGCCCACAACCATTCCCTCAGCCCAATTGACCGAAAGGGCGCGA';
msg_int = zeros(size(seq));
msg_int(seq=='A') = 1;
msg_int(seq=='C') = 2;
msg_int(seq=='G') = 3;
msg_int(seq=='T') = 4;